Example coding DNA reference sequences - alternatively spliced exons

Last modified April 3, 2006

Since references to WWW-sites are not yet acknowledged as citations, please mention den Dunnen JT and Antonarakis SE (2000). Hum.Mutat. 15:7-12 when referring to these pages.

Exon larger at 5' end

Detailed expression analysis of this fictive gene showed that a minor fraction of the transcripts (<5%) contained an alternatively spliced exon 54, extending it with the last 27 nucleotides of intron 53. Based on a coding DNA reference sequence, numbering of these differentially spliced nucleotides is straightforward, i.e. as for the intronic nucleotides c.9661-27 to c.9661-1. The encoded amino acids can best be numbered p.Val3221-9 to p.Gln3221-1; this number clearly indicates their position in relation to the other amino acids with the '-' number indicating a location in an intron (see below).

Exon 53

         .         .         .         .         .         . |
Y  E  E  K  M  A  R  R  L  L  G  P  Q  N  A  A  A  V  F  Q   |    3220

         .         .         .         .         .         .
gtacgtatggcatgtttttatttcccgtacgaggtaagcctccaaagaccttgagaattc      9660+60

         .         .         .         .         .         .
gtgaagtgtaattagcattacaacagggccctggaagctgtggacctaatgctcttcctg      9660+120

         .         .         .         .         .         .
tgataaatcatttttgcatttatgacttgaaaaatattttgataagctaggagttaagag      9660+180

         .         .         .         .         .         .
ccagaatgtagattgctctcagattagaaaacaaacaaaaccctgagacactcattttgc      9660+240

         .         .         .         .         .         .
aaatagtggaatgagtcgacatatagcctttggttctttccctttctcgcccatggattt      9660+300

         .         .         .         .         .         .
tggaattcttccatgcacttcaggggtggcttcctctcactggcggccatggctgtgctc      9660+360

         .         .         .         .         .         .
ctggagatactggcacacctgtctccagatcagaatggtcttagctgatacttaggacac      9660+420

         .         .         .         .         .         .
ttttgcagaagattatgaattgataggccaaacaaaatgaaaacaagcccttaatacagc      9660+480

         .         .         .         .         .         .
aaacttagcttctcaaactgagaacatttttcgttttcttttgttttttaataagatttt      9660+540

         .         .         .         .         .         .
atgaagtttcagtttggcgcctccattcatcactctctcttagagaacaattgtttgttt      9660+600

         .         .         .         .         .         .
tggattgcacacaagggagatatccccagttctgatttttttttttcttgagcttaatga      9660+660

         .         .         .         .         .         .
agacaattgaagaagggagcagaaggaattggtcttaattttgcctaaattcttcttaga      9660+720

         .         .   
tctcaaaattattacatgcctcatt   9660+745

--------------------- middle of intron ---------------------

                                        .         .         
                         9661-744   ataaaattagcttattaataaatt      9661-721

.         .         .         .         .         .         
tgttatgtgaaatgctttatttcagttttctatatgcaaatatagaaaatgctatgcaaa      9661-661

.         .         .         .         .         .         
taaaagcaatctatattaaaacactgatatagcaacaggttatttataaatttatttttt      9661-601

.         .         .         .         .         .         
agatcatatatttgaatgttgtttaatagagtatgatatttttcttacggagataaacat      9661-541

.         .         .         .         .         .         
ttatattctatattatgtgttatgtggcctgaagtaattaattttctttcaataaggggc      9661-481

.         .         .         .         .         .         
aatctgatgaagatctgagcatttaagagggctgagcagttagttgctggtaattttttt      9661-421

.         .         .         .         .         .         
ggcttccatgaccaaagtaggtaatttgctttagtaaccaaagtagattggtgaagatta      9661-361

.         .         .         .         .         .         
gtaattcttctgcttaccaacttaaaccaaggtggctttccataggtgaatagaattttt      9661-301

.         .         .         .         .         .         
ttttcttaatttatgtagaacttttgcagttcaaataagggtttttaggaattgaaactt      9661-241

.         .         .         .         .         .         
ggtaaacattcagtggtcaagttggttgaatttccattgcattgtaggtcatcagtcaaa      9661-181

.         .         .         .         .         .         
gagataatgaatttggaaaagttcaaaacaatcttaataaaacagtggtcaatagagttc      9661-121

.         .         .         .         .         .         
acacatcattgagcactttactcctttatttttccttttcaaggctttattcttaactag      9661-61

.         .         .         .   |        .         .         
aattctgccatctccttgtgtttttctttctag | gttttctgctttgattctgcatttcag   9661-1
                         3221-9   | V  F  C  F  D  S  A  F  Q     3221-1

| 54       .         .         .         .         .         .
| D  A  I  Q  E  K  F  Y  P  P  R  F  I  Q  V  P  E  N  M  S      3240

| Top of page | MutNomen homepage | Check-list |
| Recommendations:  DNARNAprotein, uncertain | Symbols, codons, etc. |
| Discussions | FAQ's | History |
| Example descriptions:  QuickRef / symbolsDNARNAprotein |

Copyright HGVS 2007 All Rights Reserved
Website Created by Rania Horaitis, Nomenclature by J.T. Den Dunnen - Disclaimer