Example coding DNA reference sequences - alternatively spliced exons


Last modified April 3, 2006

Since references to WWW-sites are not yet acknowledged as citations, please mention den Dunnen JT and Antonarakis SE (2000). Hum.Mutat. 15:7-12 when referring to these pages.


Exon entirely in intron

Detailed expression analysis of this fictive gene showed that a minor fraction of the transcripts (<5%) contained an alternatively spliced exon located entirely inside intron 53. Based on a coding DNA reference sequence, numbering of these differentially spliced nucleotides is straightforward, i.e. as for the intronic nucleotides c.9660+290 to c.9660+319. The encoded amino acids can best be numbered p.Pro3220+1 to p.Gln3220+10; this number clearly indicates their position in relation to the other amino acids with the '+' number indicating a location in an intron (see below).

Exon 53

         .         .         .         .         .         . |
TATGAAGAGAAGATGGCTCGCAGATTGCTAGGACCACAGAATGCAGCTGCTGTGTTTCAA |    9660
Y  E  E  K  M  A  R  R  L  L  G  P  Q  N  A  A  A  V  F  Q   |    3220

         .         .         .         .         .         .
gtacgtatggcatgtttttatttcccgtacgaggtaagcctccaaagaccttgagaattc      9660+60

         .         .         .         .         .         .
gtgaagtgtaattagcattacaacagggccctggaagctgtggacctaatgctcttcctg      9660+120

          .         .         .         .         .         .
tgataaatcatttttgcatttatgacttgaaaaatattttgataagctaggagttaagag      9660+180

         .         .         .         .         .         .
ccagaatgtagattgctctcagattagaaaacaaacaaaaccctgagacactcattttgc      9660+240

         .         .         .         .          | .         .
aaatagtggaatgagtcgacatatagcctttggttctttccctttctag | cccatggattt   9660+300
                                         3220+1   | P  M  D  F    3220+4

         .          | .         .         .         .         .
tggaattcttccatgcacg | gtgagtctggcttcctctcactggcggccatggctgtgctc   9660+360
 G  I  L  P  C  T   |   3220+10

        .         .         .         .         .         .
ctggagatactggcacacctgtctccagatcagaatggtcttagctgatacttaggacac      9660+420

         .         .         .         .         .         .
ttttgcagaagattatgaattgataggccaaacaaaatgaaaacaagcccttaatacagc      9660+480

         .         .         .         .         .         .
aaacttagcttctcaaactgagaacatttttcgttttcttttgttttttaataagatttt      9660+540

         .         .         .         .         .         .
atgaagtttcagtttggcgcctccattcatcactctctcttagagaacaattgtttgttt      9660+600

         .         .         .         .         .         .
tggattgcacacaagggagatatccccagttctgatttttttttttcttgagcttaatga      9660+660

         .         .         .         .         .         .
agacaattgaagaagggagcagaaggaattggtcttaattttgcctaaattcttcttaga      9660+720

         .         .   
tctcaaaattattacatgcctcatt   9660+745


--------------------- middle of intron ---------------------


                                        .         .         
                         9661-744   ataaaattagcttattaataaatt      9661-721

.         .         .         .         .         .         
tgttatgtgaaatgctttatttcagttttctatatgcaaatatagaaaatgctatgcaaa      9661-661

.         .         .         .         .         .         
taaaagcaatctatattaaaacactgatatagcaacaggttatttataaatttatttttt      9661-601

.         .         .         .         .         .         
agatcatatatttgaatgttgtttaatagagtatgatatttttcttacggagataaacat      9661-541

.         .         .         .         .         .         
ttatattctatattatgtgttatgtggcctgaagtaattaattttctttcaataaggggc      9661-481

.         .         .         .         .         .         
aatctgatgaagatctgagcatttaagagggctgagcagttagttgctggtaattttttt      9661-421

.         .         .         .         .         .         
ggcttccatgaccaaagtaggtaatttgctttagtaaccaaagtagattggtgaagatta      9661-361

.         .         .         .         .         .         
gtaattcttctgcttaccaacttaaaccaaggtggctttccataggtgaatagaattttt      9661-301

.         .         .         .         .         .         
ttttcttaatttatgtagaacttttgcagttcaaataagggtttttaggaattgaaactt      9661-241

.         .         .         .         .         .         
ggtaaacattcagtggtcaagttggttgaatttccattgcattgtaggtcatcagtcaaa      9661-181

.         .         .         .         .         .         
gagataatgaatttggaaaagttcaaaacaatcttaataaaacagtggtcaatagagttc      9661-121

.         .         .         .         .         .         
acacatcattgagcactttactcctttatttttccttttcaaggctttattcttaactag      9661-61

.         .         .         .         .         .         
aattctgccatctccttgtgtttttctttctaggttttctgctttgattctgcatttcag      9661-1

| 54       .         .         .         .         .         .
| GATGCAATCCAGGAGAAATTTTACCCACCACGTTTCATTCAAGTGCCAGAGAACATGTCG    9720
| D  A  I  Q  E  K  F  Y  P  P  R  F  I  Q  V  P  E  N  M  S      3240


| Top of page | MutNomen homepage | Check-list |
| Recommendations:  DNARNAprotein, uncertain | Symbols, codons, etc. |
| Discussions | FAQ's | History |
| Example descriptions:  QuickRef / symbolsDNARNAprotein |

Copyright HGVS 2007 All Rights Reserved
Website Created by Rania Horaitis, Nomenclature by J.T. Den Dunnen - Disclaimer