Open for comments - SVD-WG004

Proposal

SVD-WG004 (ISCN<>HGVS) suggest to extend the current HGVS recommendations for the description of sequence variants with the proposal below. Comments can be sent to the HGVS/HVP/HUGO Sequence Variant Description Working Group (SVD-WG), addressed to "Varnomen @ variome.org", Subject: SVD-WG004. Comments need to be sent ultimately January 15, 2016.

HGVS<>ISCN

The current HGVS recommendations (see Recommendations) do not cover translocations. One small example is given (see DNA sequence variants) but this is insufficient to properly describe the changes detected. The SVD-WG has received the request to extend the HGVS recommendations to include the description of translocations.

Historically the description of translocations is the responsibility of the ISCN committee. The ISCN recommendations cover the description of chromosome numerical and structural changes detected using microscopic / cytogenetic techniques, while the HGVS recommendations cover the description of changes at the nucleotide level detected using sequencing. Given the increased use of sequencing technologies to characterize chromosomal abnormalities the ISCN committee and the HGVS/HVP/HUGO Sequence Variant Description Working Group (SVD-WG) have thoroughly checked and discussed the recommendations of both committees. The committees decided to design one format that, wherever possible, leaves existing standards intact but that also draws a clear border between ISCN and HGVS. Discussions concentrated around earlier proposals for the description of translocations, e.g. as presented at the HGVS/ASHG meeting in Boston (see presentation), and a paper from Ordulu et al. (2014) reporting sequencing results of structural chromosome rearrangements.

The committees propose that as soon as nucleotide positions are used in the description of rearrangements, HGVS nomenclature is followed and descriptions are split in a ISCN part and a HGVS part.

• the basics
  
• only aberrant findings are described
• both the ISCN-like description of chromosome aberrations and the HGVS-like nucleotide variant descriptions must be included for full clarity and information
• the ISCN-like portion of the description appears first and can be modeled on the short or long form ISCN description of structural rearrangements
• the ISCN-like portion of the description begins with "seq" to indicate that the aberration was identified by sequence-based technology.  The description must include the genome build in square brackets after "seq[..]".
• the combined nomenclature uses the existing HGVS standards (see HGVS website) for the HGVS-like portion, along with additional recommendations outlined below
• HGVS additions
• aberrations affecting autosomes are listed first (numbers from low to high), followed by those affecting sex chromosomes (X then Y)
• to determine the location of the break point, the general HGVS rule of maintaining the longest unchanged sequence applies (the 3' rule). Break point location is determined by the first break point encountered, i.e. from pter of the chromosome with the lowest number
• multiple breakpoints in one chromosome are listed in order of occurrence from pter to qter
• variant descriptions are always in the forward orientation (from nucleotide 1 to the end of the chromosome), determined by the chromosomal origin of the intact centromere
• inverted sequences are described using "inv"
• the start of the chromosome is described as "pter", the end as "qter", the centromere as "cen"
  NOTE: since the genomic reference sequence contains N's at the start/end of the chromosome (telomeres) the use of specific nucleotide positions is undesirable
  NOTE: the use of "cen" helps to recognize the derivative chromosome
• the presence of an additional sequence (marker/ring chromosome) is indicated by "add"
  NOTE: "ext" is not available since it is already used to describe protein extension variants
• translocation, transposition, ring chromosome and chromothripsis break points (junctions) are designated by a "::" (double colon)
• non-template sequences ("inserts") at imperfect breakpoints are described using the format "::sequence::" (e.g. ::AAGTAC:: )

Examples

Note the format: the variant is first described using ISCN nomenclature, next using HGVS.

• Translocations
• balanced
  
• between short arms chromosomes 2 and 11
       seq[GRCh37] t(2;11)(p25.1;p15.2)
       g.[chr2:pter_8247756::chr11:15825273_cen_qter]
       g.[chr11:pter_15825272::chr2:8247757_cen_qter]
  
  
• between long arms chromosomes 2 and 11, with 5 bp deletion of chr11 sequence
       seq[GRCh37] t(2;11)(q31.1;q22.3)
       g.[chr2:pter_cen_174500098::chr11:108111987_qter]
       g.[chr11:pter_cen_108111981::chr2:174500099_qter]
       NOTE: coupling chr11:108111981 to 108111987 implies nucleotides 108111982_108111986 are deleted
  
• between short arm chromosome 3 and long arm chromosomes 14, with insertion of non-templated sequence at the break point on the derivative 3 chromosome
       seq[GRCh37] t(3;14)(14qter->14q12::3p22.2->3qter;14pter->14q12::3p22.2->3pter)
       g.[chr14:pter_cen_29745313::chr3:pter_36969141inv]
       g.[chr14:29745314_qterinv::CATTTGTTCAAATTTAGTTCAAATGA::chr3:36969142_cen_qter]
  
  
• between homologous chromosomes (based on Ordulu et al. example)
       seq[GRCh37] t(9;9)(9qter->9q22.33::9p21.2->9qter;9pter->9q22.33::9p21.2->9pter)
       g.[chr9:102425452_qterinv::chr9:26393002_cen_qter]
       g.[chr9:pter_cen_102425451::chr9:26393001pterinv]
  
  
• unbalanced
• derivative chromosome 2, translocation between short arms chromosomes 2 and 11
       seq[GRCh37] der(2)t(2;11)(p25.1;p15.2)
       g.[chr2:pter_8247756delinschr11:pter_15825266]
  
• derivative chromosome 3, translocation between long arms chromosomes 3 and 8, with an estimated nucleotide range for the break point on chromosome 8 (based on Uncertain Break point Localization example from Ordulu et al.)
       seq[GRCh37] der(3)(3pter->3q25.32::8q24.21->8qter)
       g.[chr3:158573187_qterdelinschr8:(128534000_128546000)_qter]
  
• derivative chromosome 5, translocation between short arm chromosome 5 and long arm chromosome 10 with homology at the break point (chr5 29658440_29658442 and chr10 67539995_67539997, based on Homology examples in Ordulu et al.)
       seq[GRCh37] der(5)t(5;10)(p13.3;q21.3)
       g.[chr5:pter_29658442delinschr10:67539995_qterinv]
  
  
• Inversion, pericentric
  
• with substitution at break point
       seq[GRCh37] inv(6)(pter->p25.3::q16.1->p25.3::q16.1->qter)
       chr6:g.[776788_93191545inv;93191546T>C]
  
• de novo with 275bp deletion and 1bp insertion at break points
       seq[GRCh37] inv(2)(pter->p22.3::q31.1->p22.3::q31.1->qter)dn
       chr2:g.[32310435_32310710del;32310711_171827243inv;insG]
  
• Deletion
  
• within a chromosome (based on Ordulu et al. Fig 1D)
       seq[GRCh37] del(X)(q21.31q22.2)
       chrX:g.89555676_100352080del
  
• ring chromosome derived from chromosome 22
       seq[GRCh37] r(22)(p11.2q13.1)
       chr22:g.[pter_10000000del::40000000_qterdel]
  NOTE:  "::"  is used to indicate the join instead of ";" to describe two not connected deletions
  
• Insertion
• Duplication  (tandem)
  
• within a chromosome, orientation same relative to original sequence (based on Ordulu et al. Fig 5)
       seq[GRCh37] dup(8)(q24.21q24.21)
       chr8:g.128746677_128749160dup
  
• within a chromosome, orientation reversed relative to original sequence
       seq[GRCh37] dup(8)(q24.21q24.21)
       chr8:g.128746677_128749160dupinv
  
• Insertion
• inserted sequence reversed in orientation relative to chromosome sequence containing centromere
       seq[GRCh37] der(4)ins(4;X)(q28.3;q22.2q21.31)
       g.[chr4:134850793_134850794inschrX:89555676_100352080inv]
• Transposition
  
• balanced  (deletion + insertion elsewhere)
  
• (balanced intrachromosomal) inserted sequence same orientation as chromosome sequence containing centromere (based on Ordulu et al. Fig.1C)
       seq[GRCh37] ins(4;X)(q28.3;q21.31q22.2)
       g.[chr4:134850793_134850794inschrX:89555676_100352080]  chrX:g.89555676_100352080del
  
• (balanced intrachromosomal) inserted sequence reversed in orientation relative to chromosome sequence containing centromere
       seq[GRCh37] ins(4;X)(q28.3;q22.2q21.31)
       g.[chr4:134850793_134850794inschrX:89555676_100352080inv]  chrX:g.89555676_100352080del
  
• Additional chromosome
  
• supernumerary ring chromosome derived from chromosome 22
       seq[GRCh37] +r(22)(p11.2q13.1)
       chr22:g.add[pter_10000000del::40000000_qterdel]

| Varnomen homepage | Comments homepage | Symbols, codons, etc. |